| Primary Identifier | MGI:5662431 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pla2g7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Pla2g7-7002J-F3490 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: TAGCCAGTCCGCCTAAAAGT, AGTAGGTGCTAGGAATTCCA, GTCATTCTCAGGAGACTGCA, and GCTGTTGCAACAGGGATGGC, which resulted in a 301 bp deletion beginning in intron 3 at Chromosome 17 positive strand position 43,594,225 bp, CTACTTTTAGGCGGACTGGCTA, and ending after CTAACCGGCCATCCCTGTTG at 43,594,525 bp (GRCm38/mm10) in intron 4. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 35 and early truncation 30 amino acids later. There is an additional 16 bp deletion 12 bases before the beginning of the 301 bp deletion. This additional deletion is in intron 3 and is not expected to impact the exon deletion results. |
