|  Help  |  About  |  Contact Us

Allele : Krt80<em1(IMPC)J> keratin 80; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5662436 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Krt80
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Krt80-6977J-M3128 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: ACTTCCTCTTTCTCCACCTT,CACCCCACCAGAGTACAGCC, TGACAGGGAGCCCCACCTCG, and AGATGAGCTGCCCTGTGACA, which resulted in a 378 bp deletion beginning in intron 2 at Chromosome 15 negative strand position 101,364,511 bp, GTGACAGGGAGCCCCACCTCG, and ending after CTGGTGGGGTGCACCCAAG at 101,364,134 bp (GRCm38/mm10) in intron 3. This mutation deletes exon 2 and is predicted to cause an early stop after amino acid residue 101.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Krt80<em1J>,
  • Krt80<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories