| Primary Identifier | MGI:5662436 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Krt80 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Krt80-6977J-M3128 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: ACTTCCTCTTTCTCCACCTT,CACCCCACCAGAGTACAGCC, TGACAGGGAGCCCCACCTCG, and AGATGAGCTGCCCTGTGACA, which resulted in a 378 bp deletion beginning in intron 2 at Chromosome 15 negative strand position 101,364,511 bp, GTGACAGGGAGCCCCACCTCG, and ending after CTGGTGGGGTGCACCCAAG at 101,364,134 bp (GRCm38/mm10) in intron 3. This mutation deletes exon 2 and is predicted to cause an early stop after amino acid residue 101. |
