| Primary Identifier | MGI:5688776 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cdrt4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Cdrt4-7035J-M1117 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, GCATCTGTCACGGTGAGTAG, CTGGCTACTGAACCACCTCA, ACAAAGAGGGAAGGCTAGTC, and AGGGCATGACCCATAGAGTT, which resulted in a 396 bp deletion beginning before the 5 UTR at Chromosome 11 positive strand position 62,951,152 bp, GTCACAATGCCTCTACTCACCG, and ending after CAAGATCACAGTTCACATCACCT at 62,951,547 bp (GRCm38/mm10) in intron 2. This mutation deletes exon 1 and is predicted to result in a null allele. |
