|  Help  |  About  |  Contact Us

Allele : Cdrt4<em1(IMPC)J> CMT1A duplicated region transcript 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5688776 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cdrt4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Cdrt4-7035J-M1117 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, GCATCTGTCACGGTGAGTAG, CTGGCTACTGAACCACCTCA, ACAAAGAGGGAAGGCTAGTC, and AGGGCATGACCCATAGAGTT, which resulted in a 396 bp deletion beginning before the 5 UTR at Chromosome 11 positive strand position 62,951,152 bp, GTCACAATGCCTCTACTCACCG, and ending after CAAGATCACAGTTCACATCACCT at 62,951,547 bp (GRCm38/mm10) in intron 2. This mutation deletes exon 1 and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Cdrt4<em1J>,
  • Cdrt4<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele