|  Help  |  About  |  Contact Us

Allele : Arhgap36<em1(IMPC)J> Rho GTPase activating protein 36; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5688777 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Arhgap36
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Arhgap36-7011J-LMP1 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GATCCAGCCTATGATGGACA, TCTCACGAAAAAACTCCTTG, and TGCCCTCCATTGTTGGAGCA, which resulted in a 163 bp deletion beginning in intron 7 at Chromosome X positive strand position 49,496,368 bp, CTTGAAGAACTGTTCAAGAT and ending after CTGAGCTCCTCAAGGAGTTTTTT at 49,496,530 bp (GRCm38/mm10) in exon 7. This 163 bp deletion removes the splice acceptor and 90 bp of exon 7 effectively deleting the entire exon and is predicted to result in early truncation 257 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Arhgap36<em1J>,
  • Arhgap36<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories