| Primary Identifier | MGI:5688777 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Arhgap36 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Arhgap36-7011J-LMP1 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GATCCAGCCTATGATGGACA, TCTCACGAAAAAACTCCTTG, and TGCCCTCCATTGTTGGAGCA, which resulted in a 163 bp deletion beginning in intron 7 at Chromosome X positive strand position 49,496,368 bp, CTTGAAGAACTGTTCAAGAT and ending after CTGAGCTCCTCAAGGAGTTTTTT at 49,496,530 bp (GRCm38/mm10) in exon 7. This 163 bp deletion removes the splice acceptor and 90 bp of exon 7 effectively deleting the entire exon and is predicted to result in early truncation 257 amino acids later. |
