|  Help  |  About  |  Contact Us

Allele : Adgra1<em1(IMPC)J> adhesion G protein-coupled receptor A1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5688779 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Adgra1
Strain of Origin  C57BL/6NJ Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project Adgra1-6965J-M4387 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, GTGACTGATACGGATGGCCA, ACAAGTCACATAAAGAGCCC, GTCCCAGGATGGAAGGATTG, and GGCTCAAGTCCCAGGATGGA, which resulted in a 254 bp deletion beginning in intron 4 at Chromosome 7 positive strand position 139,845,536 bp, GAGCCCTGGCCATCCGTATCAGT, and ending after CCCAATCCTTCCATCCTGG at 139,845,789 bp(GRCm38/mm10) in intron 5. The 254 bp mutation deletes all of exon 4 and is predicted to result in a change of amino acid sequence after amino acid 4 and early truncation 61 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Adgra1<em1J>,
  • Adgra1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories