| Primary Identifier | MGI:5689889 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc6a20b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Slc6a20b-6846J-M9395 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, AGAGGATACAGGCCTCTAGG, ACTTCAATGTCATCAACACC and TCTGTCCTAGGGATCTTTAC, which resulted in a 183 bp deletion beginning at Chromosome 9 negative strand position 123,610,427 bp, TTACAGGTTGGGCTATTCACA, and ending after GGGAGAGGATACAGGCCTC, at 123,610,245 bp (GRCm38/mm10) in intron 4. This 183 bp mutation completely deletes exon 3 and flanking intronic sequences. It is predicted to result in a change in amino acid sequence after amino acid 131 and early truncation 10 amino acids later. |
