| Primary Identifier | MGI:5689895 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Prkx |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Prkx-6999J-M3432 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, ATAACGTTAGGGAGGTGAGG, CTCTTGGGAGAATAACGTTA, TTATCTTTAAGGCCCCAGAT, and ATGGACATCATGCCAATCTG, which resulted in a 283 bp deletion beginning in intron 2 at Chromosome X negative strand position 77,786,367 bp,TTGGCATGATGTCCATTCCTC, and ending after CCACCTCCTCACCTCCCTAA at 77,786,085 bp(GRCm38/mm10) in intron 3. The 283 bp mutation deletes all of exon 2 and is predicted to result in a change of amino acid sequence after amino acid 54 and early truncation 12 amino acids later. |