|  Help  |  About  |  Contact Us

Allele : Prkx<em1(IMPC)J> protein kinase, X-linked; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5689895 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Prkx
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Prkx-6999J-M3432 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, ATAACGTTAGGGAGGTGAGG, CTCTTGGGAGAATAACGTTA, TTATCTTTAAGGCCCCAGAT, and ATGGACATCATGCCAATCTG, which resulted in a 283 bp deletion beginning in intron 2 at Chromosome X negative strand position 77,786,367 bp,TTGGCATGATGTCCATTCCTC, and ending after CCACCTCCTCACCTCCCTAA at 77,786,085 bp(GRCm38/mm10) in intron 3. The 283 bp mutation deletes all of exon 2 and is predicted to result in a change of amino acid sequence after amino acid 54 and early truncation 12 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Prkx<em1J>,
  • Prkx<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele