|  Help  |  About  |  Contact Us

Allele : Vwa5a<em1(IMPC)J> von Willebrand factor A domain containing 5A; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5696234 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Vwa5a
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Vwa5a- 7101J M#8480 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, CCAGAACTACTCCTCATCTA, GGCGACCTTTGTGTTTCCTA, TGGGCACATAGTAATTAAAA, which resulted in a 376 bp deletion in intron 3 beginning at Chromosome 9 positive strand position 38,722,488 bp, CTATGGGTGTTACTCTAGAAAAGC, and ending after GTTCTTTTATTCATTCCCTTT at 38,722,863 bp (GRCm38/mm10) in intron 4. This mutation deletes exon 3 and is predicted to result in amino acid sequence change after residue 14 and early truncation 5 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Vwa5a<em1J>,
  • Vwa5a<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories