|  Help  |  About  |  Contact Us

Allele : Abhd17b<em1(IMPC)J> abhydrolase domain containing 17B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5696235 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Abhd17b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Abhd17b-7064J-M4843 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, GTCATTAAACCTATTTGGGA, TTTCAAGAACCCTCCCAAAT, ATGCTGCATAAGTTATACTG, and GTATAACTTATGCAGCATAA, which resulted in a 632 bp deletion in intron 2 beginning at Chromosome 19 positive strand position 21,678,217 bp, ATTTGGGAGGGTTCTTGAAATTATA, and ending after TGGTTTTTACCCTTATGCTGCA at 21,678,848 bp (GRCm38/mm10) in intron 3. This mutation deletes exon 2 and the splice acceptor and is predicted to generate a null allele.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Abhd17b<em1J>,
  • Abhd17b<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories