| Primary Identifier | MGI:5696235 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Abhd17b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Abhd17b-7064J-M4843 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, GTCATTAAACCTATTTGGGA, TTTCAAGAACCCTCCCAAAT, ATGCTGCATAAGTTATACTG, and GTATAACTTATGCAGCATAA, which resulted in a 632 bp deletion in intron 2 beginning at Chromosome 19 positive strand position 21,678,217 bp, ATTTGGGAGGGTTCTTGAAATTATA, and ending after TGGTTTTTACCCTTATGCTGCA at 21,678,848 bp (GRCm38/mm10) in intron 3. This mutation deletes exon 2 and the splice acceptor and is predicted to generate a null allele. |
