| Primary Identifier | MGI:5697043 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cldn13 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Cldn13-6968J-M3024 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CATGGTCGTCAGCAAACAAG, along with a non-contributing plasmid, which resulted in a 1 bp insertion (G) in exon 1 beginning at Chromosome 5 negative strand position 134,915,313 bp (GRCm38/mm10). This mutation is predicted to cause amino acid sequence changes after residue 5 and early truncation 31 amino acids later. |
