| Primary Identifier | MGI:5697047 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gpr15 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Gpr15-6923J-M9817 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ATACAACTGTGTAAAAGATA, with a non-contributing plasmid, which resulted in an 8 bp deletion (CTCCCTAT) in exon 1 beginning at Chromosome 16 negative strand position 58,718,619bp (GRCm38/mm10). This mutation is predicted to cause amino acid sequence changes after residue 36 and early truncation 39 amino acids later. |
