| Primary Identifier | MGI:5697049 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rxfp3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rxfp3-6943J-F9508 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GGTGGCTTCTGCAACCCCCG, with a non-contributing plasmid, which resulted in a 20 bp deletion (TGCAGGTGGCTTCTGCAACC) in exon 1 beginning at Chromosome 15 positive strand position 11,037,264 bp (GRCm38/mm10). The 20 bp deletion alters the coding sequence such that the first 11 amino acids are changed followed by a stop codon, and is therefore predicted to be a null allele. |
