|  Help  |  About  |  Contact Us

Allele : Rxfp3<em1(IMPC)J> relaxin family peptide receptor 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5697049 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rxfp3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Rxfp3-6943J-F9508 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GGTGGCTTCTGCAACCCCCG, with a non-contributing plasmid, which resulted in a 20 bp deletion (TGCAGGTGGCTTCTGCAACC) in exon 1 beginning at Chromosome 15 positive strand position 11,037,264 bp (GRCm38/mm10). The 20 bp deletion alters the coding sequence such that the first 11 amino acids are changed followed by a stop codon, and is therefore predicted to be a null allele.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Rxfp3<em1J>,
  • Rxfp3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele