|  Help  |  About  |  Contact Us

Allele : Kcnc3<em1(IMPC)J> potassium voltage gated channel, Shaw-related subfamily, member 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5697086 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Kcnc3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Kcnc3-7063J-F4895 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GCTTCTAAAGAACTTGGTGG, CTACTATGCCGAACGCATCG, and AGAGGTGATTGAAACCAACA, which resulted in a 1182 bp deletion in exon 2 beginning at Chromosome 7 positive strand position 44,595,080 bp, GTGAGGCCACCACCAAGTTCTTTAG, and ending after CAAGAAGAGGTGATTGAAACCAACA at 44,596,261 bp (GRCm38/mm10). This mutation deletes most of exon 2, except for the last 7 bp, and deletes the splice acceptor. It is predicted to result in a change in amino acid sequence after 291 amino acid residues and early truncation 71 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Kcnc3<em1J>,
  • Kcnc3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories