|  Help  |  About  |  Contact Us

Allele : Engase<em2Lutzy> endo-beta-N-acetylglucosaminidase; endonuclease-mediated mutation 2, Cathy Lutz

Primary Identifier  MGI:5700326 Allele Type  Endonuclease-mediated
Gene  Engase Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  The allele was generated by injecting Cas9 RNA and guide sequences homologous to Engase exon 3 (GTGGAGGCCGGCGACACACC and GGAGGCCGGCGACACACCAG). The CRISPR/cas9 endonuclease mediated genome editing introduced a 4 nt (gtgt) deletion within exon 3. The mutant generated contains a discrete 4 nt GTGT deletion in exon 3 within the Engase open reading frame causing a frameshift beginning at Val 104 and leading to translation termination 18 amino acids later. The mutant mouse is predicted to express a 121 amino acid 13.5 kDa polypeptide from the Engase gene.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Engase<em2(4del)Lutzy>,
  • Engase<em2(4del)Lutzy>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories