| Primary Identifier | MGI:5700326 | Allele Type | Endonuclease-mediated |
| Gene | Engase | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The allele was generated by injecting Cas9 RNA and guide sequences homologous to Engase exon 3 (GTGGAGGCCGGCGACACACC and GGAGGCCGGCGACACACCAG). The CRISPR/cas9 endonuclease mediated genome editing introduced a 4 nt (gtgt) deletion within exon 3. The mutant generated contains a discrete 4 nt GTGT deletion in exon 3 within the Engase open reading frame causing a frameshift beginning at Val 104 and leading to translation termination 18 amino acids later. The mutant mouse is predicted to express a 121 amino acid 13.5 kDa polypeptide from the Engase gene. |
