|  Help  |  About  |  Contact Us

Allele : Loxl1<em2J> lysyl oxidase-like 1; endonuclease-mediated mutation 2, Jackson

Primary Identifier  MGI:5706768 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready Gene  Loxl1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
molecularNote  This loxP flanked allele from project Loxl1-6513J-101P2M(2R)was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, GAATGGCATGCCACAAGTAA and TCAGATACTTTGCCAGACTC, along with a plasmid containing 2618 bp of Loxl1 sequence comprised of 1 kb 5-prime and 3-prime homology arms with two 60 bp-cassettes flanking exon 2 that contain a loxP site, HindIII cut site, and an additional unique 20 bp sequence as a sequencing primer. This allele shows a complete integration of the Loxl1 2618 bp sequence by homologous recombination beginning in Chromosome 9 negative strand position 58,298,994 bp CATGACTCAAGCACCCCATCTTTAC, and ending after GGACTATCTTAAGTGCCCAGC at 58,296,497 bp (GRCm38), resulting in a loxP flanked exon 2. It is predicted that mating this strain with cre will generate a deletion of exon 2 causing a change of amino acid sequence after amino acid 400 and early truncation 22 amino acids later.
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories