| Primary Identifier | MGI:5749801 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hpse2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Hpse2-7398J-F2290 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTCCTCCAACACTCAAAAT, GTCCCGATTTTGAGTGTTGG, GTGCTCTCTAGCCTTCTCCC, and TAGATAATAAATCTCCCACC, which resulted in a 285 bp deletion spanning exon 2 beginning at Chromosome 19 negative strand position 43,385,002 bp, CCCACCAGGTCTCCTGCAGG and ending after AGAAATTTGGTCCCGATTTT at 43,384,718 bp (GRCm38/mm10). This mutation deletes exon 2 and 127 bp of intronic sequence including the splice acceptor and donor. This mutation is expected to cause an amino acid sequence change after 96 amino acids and early truncation 4 amino acids later. |
