|  Help  |  About  |  Contact Us

Allele : Zwint<em1(IMPC)J> ZW10 interactor; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5749807 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zwint
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Zwint-7383J-M709 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGATAGCCTCTTGAAATAGT, GCGTTTCAGAAGACAGGGGG, CTGTGAACGAGAGCTCTAGA, and CCTTCCCATGAGGCAGACAC, which resulted in a 321 bp deletion spanning exon 3 beginning at Chromosome 10 positive strand position 72,656,150 bp, AGTGGGCAGCAATGGGGAAGA and ending after GGAAGGAAGGCTGTGAACGAGAGCTC at 72,656,470 bp (GRCm38/mm10). This mutation deletes exon 3 and 197 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause amino acid sequence change after residue 50 and early truncation 13 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Zwint<em1J>,
  • Zwint<em1J>,
  • Zwint<->,
  • Zwint<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories