| Primary Identifier | MGI:5749809 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dgkh |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Dgkh-7399J-M2307 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAAGATGCAAGTTTTGGCC, GTACATAGATACCTTATCTC, GCTTCGGTGTTCACAGTAAC, and CGAAGACAACGTTCAGTCAG, which resulted in a 295 bp deletion spanning exon 5 beginning at Chromosome 14 positive strand position 78,627,550 bp, GCCAAAACTTGCATCTTAATT, and ending after AAGACAACGTTCAGTCAGAG at 78,627,844 bp (GRCm38/mm10). There is also a 6bp (ctgtta) insertion in the intron that will not affect the exon deletion. This mutation deletes exon 5 and 164 bp of intronic sequence including the splice acceptor and donor. This mutation causes amino acid sequence change after residue 160 and early truncation 11 amino acids later. |