|  Help  |  About  |  Contact Us

Allele : Dgkh<em1(IMPC)J> diacylglycerol kinase, eta; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5749809 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dgkh
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Dgkh-7399J-M2307 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAAGATGCAAGTTTTGGCC, GTACATAGATACCTTATCTC, GCTTCGGTGTTCACAGTAAC, and CGAAGACAACGTTCAGTCAG, which resulted in a 295 bp deletion spanning exon 5 beginning at Chromosome 14 positive strand position 78,627,550 bp, GCCAAAACTTGCATCTTAATT, and ending after AAGACAACGTTCAGTCAGAG at 78,627,844 bp (GRCm38/mm10). There is also a 6bp (ctgtta) insertion in the intron that will not affect the exon deletion. This mutation deletes exon 5 and 164 bp of intronic sequence including the splice acceptor and donor. This mutation causes amino acid sequence change after residue 160 and early truncation 11 amino acids later.
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • Dgkh<em1J>,
  • Dgkh<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele