| Primary Identifier | MGI:5749850 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ap3m2 |
| Strain of Origin | C57BL/6NTac | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | CRISPR endonuclease technology mediated a mutation that results in the amino acid substitution of leucine for proline at position 157 (L157P). This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, the guide sequence TGGAAGCTGGTCCCCCACATTGG, and a donor oligo, which resulted in a Indel. |
