|  Help  |  About  |  Contact Us

Allele : Ust<em1(IMPC)J> uronyl-2-sulfotransferase; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5749738 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ust
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Ust-7382J-F715 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATTTGAGTAAGCTGTTAAG, TGATTTGAGTAAGCTGTTAA, ACAGCTGAGCTTGTTGCAAA, and GGCAGATAACCATTAGCGTG, which resulted in a 221 bp deletion spanning exon 4 beginning at Chromosome 10 negative strand position 8,307,547 bp, TTAGCGTGTGGCTTAGAGAG, and ending after GCTCCATCTAATGAGCAACCCCT at 8,307,327 bp (GRCm38/mm10). This mutation deletes exon 4 and 141 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid change after residue 150 and early truncation 17 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ust<em1J>,
  • Ust<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories