| Primary Identifier | MGI:5749789 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cdin1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project BC052040-7395J-M2241 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGAAACATGTGCACACAG, GGTCATGCAGTGACAAGGAA, CTACTCTAGATAGGCCCCTT, and TAAACCTGAGCTAAACCTAA, which resulted in a 195 bp deletion spanning exon 4 beginning at Chromosome 2 positive strand position 115,638,917 bp, GGAGAAACATGTGCACACAGG, and ending after AACCTGAGCTAAACCTAAGG at 115,639,111 bp (GRCm38/mm10). This mutation deletes exon 4 and 134 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid change after residue 71 and early truncation 6 amino acids later. |
