|  Help  |  About  |  Contact Us

Allele : Tbc1d5<em1(IMPC)J> TBC1 domain family, member 5; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5750182 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tbc1d5
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tbc1d5-7380J-M1353 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATTTCAGTGATCCCTGTGT, TAGGAAAGGAACCAGATCAG, AGCACTCCTCTTGTAGTAGA, and CCTGGAAGATTACCCACACA, which resulted in a 231 bp deletion spanning exon 5 beginning at Chromosome 17 negative strand position 50,968,324 bp, CCCCTGATCTGGTTCCTTTCC, and ending after CCACACAGGGATCACTGAAA at 50,968,094 bp (GRCm38/mm10). This mutation deletes exon 5 and 112 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid sequence change after 55 residues and early truncation 14 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tbc1d5<em1J>,
  • Tbc1d5<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories