|  Help  |  About  |  Contact Us

Allele : Nectin4<em1(IMPC)J> nectin cell adhesion molecule 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5752746 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nectin4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Pvrl4-7418J-M4968 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGGACTCTGAGCTTGGGCT, GGACTCTGAGCTTGGGCTGG, TCTATGCCCCGACTTAGCTA and TCTGAACCCTAGCTAAGTCG, which resulted in a 401 bp deletion spanning exon 4 beginning at Chromosome 1 positive strand position 171,383,458 bp GGTCTTATGAGCTCAGGGCA and ending after ACATATTCTGAACCCTAGCT at 171,383,858 bp (GRCm38/mm10). This mutation deletes exon 4 and 280 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is expected to cause an amino acid sequence change after amino acid residue 242 and early truncation 11 amino acid later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Nectin4<em1J>,
  • Nectin4<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories