| Primary Identifier | MGI:5752758 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pcnx2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Pcnxl2-7417J-M4954 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAATGTTTCTGTCTGCGGTG, TTGTAACTAAGAGCTCTTTT, CTTAGAGGTTTAAAGCGAAG, and TCTTTACTGAGCACAAGTCA, which resulted in a 476 bp deletion spanning exon 2 beginning at Chromosome 8 positive strand position 125,891,793 bp, TTTTGGGAGCTGGCACTCTCCT and ending after ATCAGTCACTTTGATGACCAA at 125,892,268 bp (GRCm38/mm10). This mutation deletes exon 2 and 270 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is expected to cause an amino acid sequence change after residue 51 and early truncation 1 amino acid later. |
