| Primary Identifier | MGI:5752778 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ofcc1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ofcc1- 7447J-M8483 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGCCTGACCAAATCCATG, GCAACGCCAGTGAACATGTA, TCTTTCTTATATGGAATAAG, and AGTCAATGTTAAAACAATGA, which resulted in a 435 bp deletion spanning exon 5 beginning at Chromosome 13 negative strand position 40,255,271 bp, TTATTCCATATAAGAAAGAAA and ending after TCCTATCTTTCCACATGGAT at 40,255,271 bp (GRCm38/mm10). This mutation deletes exon 5 and 268 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause amino acid sequence change after residue 114 and early truncation 4 amino acids later. |
