|  Help  |  About  |  Contact Us

Allele : Ofcc1<em1(IMPC)J> orofacial cleft 1 candidate 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5752778 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ofcc1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Ofcc1- 7447J-M8483 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGCCTGACCAAATCCATG, GCAACGCCAGTGAACATGTA, TCTTTCTTATATGGAATAAG, and AGTCAATGTTAAAACAATGA, which resulted in a 435 bp deletion spanning exon 5 beginning at Chromosome 13 negative strand position 40,255,271 bp, TTATTCCATATAAGAAAGAAA and ending after TCCTATCTTTCCACATGGAT at 40,255,271 bp (GRCm38/mm10). This mutation deletes exon 5 and 268 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause amino acid sequence change after residue 114 and early truncation 4 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ofcc1<em1J>,
  • Ofcc1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele