|  Help  |  About  |  Contact Us

Allele : Mettl3<em1(IMPC)Tcp> methyltransferase 3, N6-adenosine-methyltransferase complex catalytic subunit; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5754605 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mettl3
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0368 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs (targeting AGGTAGCAGGGACCATCGCA and TATCTCCAGATCAACATCGG) targeting a critical region. This resulted in a 142 bp deletion from Chr14:52299764 to 52299905 (GRCm38) (GRCm39:chr14:52537221-52537362) in exon 3 (ENSMUSE00001224053). This mutation causes a frameshift and premature stop codon (p.I173Mfs*6).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

6 Publication categories