| Primary Identifier | MGI:5754605 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mettl3 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0368 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs (targeting AGGTAGCAGGGACCATCGCA and TATCTCCAGATCAACATCGG) targeting a critical region. This resulted in a 142 bp deletion from Chr14:52299764 to 52299905 (GRCm38) (GRCm39:chr14:52537221-52537362) in exon 3 (ENSMUSE00001224053). This mutation causes a frameshift and premature stop codon (p.I173Mfs*6). |
