| Primary Identifier | MGI:5754607 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ndufs2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0320 was generated at the Toronto Centre for Phenogenomics by injecting Cas9 mRNA and two single guide RNAs with spacer sequences AACCGACTATCTAAAATGAT targeting the 5' side and GTATACATCAAGGCGTGTGT targeting the 3' side of exon 4 (exon OTTMUSE00000270987). This resulted in a 547 bp deletion from Chr1:171239045 to 171239591, OTTMUSE0000027098 (GRCm38). |
