|  Help  |  About  |  Contact Us

Allele : Ndufs2<em1(IMPC)Tcp> NADH:ubiquinone oxidoreductase core subunit S2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
Primary Identifier  MGI:5754607 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ndufs2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0320 was generated at the Toronto Centre for Phenogenomics by injecting Cas9 mRNA and two single guide RNAs with spacer sequences AACCGACTATCTAAAATGAT targeting the 5' side and GTATACATCAAGGCGTGTGT targeting the 3' side of exon 4 (exon OTTMUSE00000270987). This resulted in a 547 bp deletion from Chr1:171239045 to 171239591, OTTMUSE0000027098 (GRCm38).
  • mutations:
  • Intragenic deletion
Paste the following link
Quick Links:
SummaryGenomePhenotypeOther
 
Quick Links:
SummaryGenomePhenotypeOther
 
Lists
This Allele isn't in any lists. Upload a list.

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele




MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Copyright © 2017 by The Jackson Laboratory. All Rights Reserved

© 2002 - 2017 Department of Genetics, University of Cambridge, Downing Street,
Cambridge CB2 3EH, United Kingdom