|  Help  |  About  |  Contact Us

Allele : Nek2<em1(IMPC)Tcp> NIMA (never in mitosis gene a)-related expressed kinase 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5754994 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nek2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0309 was generated at the The Centre for Phenogenomics by injecting Cas9D10A mRNA and guide RNAs with spacer sequences GGTCCCGGTGAAGCACAGTG and CAGCAAACACAATGTCAAGC, which resulted in a 2-bp insertion +TC in Chromosome 1 positive strand 191822642 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. c.465_466insTC; p.(L157Sfs*4)
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

6 Publication categories