| Primary Identifier | MGI:5754994 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nek2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0309 was generated at the The Centre for Phenogenomics by injecting Cas9D10A mRNA and guide RNAs with spacer sequences GGTCCCGGTGAAGCACAGTG and CAGCAAACACAATGTCAAGC, which resulted in a 2-bp insertion +TC in Chromosome 1 positive strand 191822642 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. c.465_466insTC; p.(L157Sfs*4) |
