|  Help  |  About  |  Contact Us

Allele : Mpz<em1(IMPC)Tcp> myelin protein zero; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5754548 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mpz
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0238 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and one guide RNA with the spacer sequence TCTTGCCCACTATGTCCGGT and an oligonucleotide repair template. Non-homologous end-joining repair resulted in a 19 bp deletion from Chr1:171158916 to 171158934 in ENSMUSE00000476648. This mutation is predicted to cause a frameshift with amino acid changes after residue 134 and early truncation 20 amino acids later (p.D134Lfs*22). The repair template was not integrated. (GRCm38).
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories