| Primary Identifier | MGI:5754568 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hgsnat |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0253, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences GCAGGTTAACTCCACCTCGG and ACAGAGACAGGTGCCACGCT. This resulted in a 38 bp deletion from Chr8:25971576 to 25971613 (GRCm38) in exon 3 (ENSMUSE00000347052). This mutation is predicted to cause a frameshift with amino acid changes after residue 133 and early truncation 24 amino acids later (p.I133Lfs*25). |
