|  Help  |  About  |  Contact Us

Allele : Hgsnat<em4(IMPC)Tcp> heparan-alpha-glucosaminide N-acetyltransferase; endonuclease-mediated mutation 4, The Centre for Phenogenomics

Primary Identifier  MGI:5754568 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Hgsnat
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0253, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences GCAGGTTAACTCCACCTCGG and ACAGAGACAGGTGCCACGCT. This resulted in a 38 bp deletion from Chr8:25971576 to 25971613 (GRCm38) in exon 3 (ENSMUSE00000347052). This mutation is predicted to cause a frameshift with amino acid changes after residue 133 and early truncation 24 amino acids later (p.I133Lfs*25).
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories