|  Help  |  About  |  Contact Us

Allele : Adarb2<em1(IMPC)Tcp> adenosine deaminase, RNA-specific, B2; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5754576 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Adarb2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele, from project TCPR0409, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences GGGGAGGTCCTCCGTCATCC, TCAGCACTTCAGGCCAGGTC, GTGAGTTGGGATATTCTTGC, and GGCCTGCTGCTCTCCCCGTG. This resulted in an indel at Chr13:8569440 del T insCCTCCTCTGA; a 1140-bp deletion on Chr13 from 8569541 to 8570680; and an indel at Chr13:85670687 insT (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories