| Primary Identifier | MGI:5754578 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Adnp2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele produced from project TCPR0357 at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences CATGCTGTAGTACAGAGTGT and CTACTTTGGTTTGCGAACTG. This resulted in an indel comprised of an 8-bp deletion on Chr18 from 80130697 to 80130704 (ENSMUSE00000429049; GRCm38). This mutation is predicted to cause a frameshift with amino acid changes after residue 164 and early truncation 14 amino acids later (p.N164V*fs16). |