|  Help  |  About  |  Contact Us

Allele : Adnp2<em3(IMPC)Tcp> ADNP homeobox 2; endonuclease-mediated mutation 3, The Centre for Phenogenomics

Primary Identifier  MGI:5754578 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Adnp2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele produced from project TCPR0357 at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences CATGCTGTAGTACAGAGTGT and CTACTTTGGTTTGCGAACTG. This resulted in an indel comprised of an 8-bp deletion on Chr18 from 80130697 to 80130704 (ENSMUSE00000429049; GRCm38). This mutation is predicted to cause a frameshift with amino acid changes after residue 164 and early truncation 14 amino acids later (p.N164V*fs16).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele