|  Help  |  About  |  Contact Us

Allele : Minar1<em1(IMPC)Tcp> membrane integral NOTCH2 associated receptor 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5754580 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Minar1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele, from project TCPR0387, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences GGGCACAGAGTGACTTGCAC, ACTGTATCCCCCAGTTTGGT and ACTTCGGGTCAGGCCAAGTA. This resulted in a 1,410 bp deletion from 89601843 to 89603253 on Chr 9 encompassing exon ENMUSE00000334339. This mutation is predicted to cause a frameshift with amino acid changes after residue 31 and early truncation 2 amino acids later (p.C31Tfs*4). (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories