|  Help  |  About  |  Contact Us

Allele : Ap2s1<em1(IMPC)Tcp> adaptor-related protein complex 2, sigma 1 subunit; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5754583 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ap2s1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was produced in project TCPR0357 at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences GCAAGACGCGCCTGGCCAAG and GATCGAGGAGGTGCACGCCG. This resulted in a 58-bp deletion in chromosome 7 from 16743267 to 16743324 (GRCm38). This mutation is predicted to cause a frameshift with amino acid changes after residue 18 and early truncation 47 amino acids later (p.K18Pfs*49).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ap2s1<->,
  • Ap2s1<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

6 Publication categories