|  Help  |  About  |  Contact Us

Allele : Ccnb1ip1<em1(IMPC)Tcp> cyclin B1 interacting protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5754587 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ccnb1ip1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0410 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TCAATACCTTGGTCTTTCCA and TTTGCAATTATCGGAAGTGT targeting the 5' side and ATCCCGCAGTCTGGAGTCTT and ACCACAGTAAACTGAGCTGT targeting the 3' side of exons ENSMUSE00000617176 and ENSMUSE00000617175. This resulted in a 2,142-bp deletion from Chr14:50791871 to 50794011 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele