| Primary Identifier | MGI:5754589 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Chchd7 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was produced from project TCPR0372 at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences ATGCAAGCATACTATTACAC and AATTTGGGCTCTTTTAGGCC. This resulted in a 1,533-bp deletion from Chr4:3942187 to 3943719 insCT (GRCm38). |
