| Primary Identifier | MGI:5754592 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Colec10 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0371 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences of GCAAATTCAAGGAACAATAT targeting the 5' side and GCTTTTGCTCAAATGCCATA targeting the 3' side of exon ENSMUSE00000352964. This resulted in a 1,111-bp deletion from Chr15:54461596 to 54462706 (GRCm38). |
