| Primary Identifier | MGI:5755027 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Poc5 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0359 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences TCGGGCTTATTGCCTTGAAG and TTCCCGGCTCTTTTGACGGT. This resulted in a 614 bp deletion and 174 bp insertion from Chr13:96392926 to 96393539, exon ENSMUSE00000119907. (GRCm38). |