|  Help  |  About  |  Contact Us

Allele : Poc5<em1(IMPC)Tcp> POC5 centriolar protein; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:5755027 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Poc5
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0359 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences TCGGGCTTATTGCCTTGAAG and TTCCCGGCTCTTTTGACGGT. This resulted in a 614 bp deletion and 174 bp insertion from Chr13:96392926 to 96393539, exon ENSMUSE00000119907. (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories